| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.175364 |
| Chromosome: | chromosome 10 |
| Location: | 3995923 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g448950 | EEP3 | Exonuclease-Endonuclease-Phosphatase superfamily protein; (1 of 1) K18764 - nocturnin [EC:3.1.13.4] (CCRN4L) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAGTACCGAAAGCCGCTGCTGATCCAGG |
| Internal bar code: | GGACGCAGATGGGTAGGTGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 811 |
| LEAP-Seq percent confirming: | 99.783 |
| LEAP-Seq n confirming: | 2759 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTTTGCTTGGCTCGAACTT |
| Suggested primer 2: | CTACCGTAGGGCTGGTGTGT |