| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.175365 |
| Chromosome: | chromosome 8 |
| Location: | 3511526 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g375150 | (1 of 1) PF11904//PF12796 - GPCR-chaperone (GPCR_chapero_1) // Ankyrin repeats (3 copies) (Ank_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGGCGTAGGCAGGGGGGGAGGGGTTGTA |
| Internal bar code: | GTTTTCAATGGCTGGGGAACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 452 |
| LEAP-Seq percent confirming: | 97.3333 |
| LEAP-Seq n confirming: | 949 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCCCAAACTAAACCAAA |
| Suggested primer 2: | CTGAAGGAGGACCTCACAGC |