| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.175385 |
| Chromosome: | chromosome 16 |
| Location: | 5878393 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g677450 | (1 of 2) 5.1.3.15 - Glucose-6-phosphate 1-epimerase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCCACCCCAGGCCACTCACTTGGCGTTCT |
| Internal bar code: | CCGAGCACTGGTCGCGTGGCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 829 |
| LEAP-Seq percent confirming: | 83.61 |
| LEAP-Seq n confirming: | 806 |
| LEAP-Seq n nonconfirming: | 158 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACGCACACTGGCTTACAG |
| Suggested primer 2: | CCCATCGGAGTAGGTCTCAA |