| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.175411 |
| Chromosome: | chromosome 12 |
| Location: | 1475629 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g487600 | CPS2 | Putative cleavage and polyadenylation specificity factor 100 kDa subunit; (1 of 1) K14402 - cleavage and polyadenylation specificity factor subunit 2 (CPSF2, CFT2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTTTGGTCGTCAGCGGGGAGTCTGTCCCA |
| Internal bar code: | TGTATCTTATGTTGCCATTTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 534 |
| LEAP-Seq percent confirming: | 99.3375 |
| LEAP-Seq n confirming: | 2849 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTCTCGCGTGCTGTAAATC |
| Suggested primer 2: | GAAGGAAAGCAGGACTGTGC |