Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.175440 |
Chromosome: | chromosome 6 |
Location: | 5406471 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g283950 | LHCBM4 | (1 of 6) K08912 - light-harvesting complex II chlorophyll a/b binding protein 1 (LHCB1); Light-harvesting Chlorophyll a/b binding protein of LHCII | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGAGGACAGGGGTCACATGAATGCAGG |
Internal bar code: | CTGCGGCGACCGGGGGAATGGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 606 |
LEAP-Seq percent confirming: | 64.6469 |
LEAP-Seq n confirming: | 3286 |
LEAP-Seq n nonconfirming: | 1797 |
LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTAAGCCATTCTTTCGCTC |
Suggested primer 2: | TTGCGATGCTCCATAGAGTG |