Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.175474 |
Chromosome: | chromosome 2 |
Location: | 7004591 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g147800 | SEC14 | (1 of 13) IPR001251//IPR011074 - CRAL-TRIO lipid binding domain // CRAL/TRIO, N-terminal domain; Putative phosphoglyceride transfer protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGTAGGCGGGTTTGTCGGCAGGTCGCCAG |
Internal bar code: | CGATATTGGAAGCGCTGTCGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 685 |
LEAP-Seq percent confirming: | 99.1736 |
LEAP-Seq n confirming: | 840 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTCTTCTCCACGCTTTAGG |
Suggested primer 2: | GCGATAGGTCCAATAGGCAA |