Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.175486 |
Chromosome: | chromosome 16 |
Location: | 2126962 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g657950 | SSA5 | cilia-sensing, structure and/or assembly; (1 of 1) K06259 - CD36 antigen (CD36) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGCCGGGCAGGAAGGGGAGGAAGGGGAG |
Internal bar code: | GCGGGATGCGACGTGACGGGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 210 |
LEAP-Seq percent confirming: | 93.345 |
LEAP-Seq n confirming: | 533 |
LEAP-Seq n nonconfirming: | 38 |
LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACGCACTTAACGCCTCAGTT |
Suggested primer 2: | CACAACAACACCACACCACA |