| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.175527 |
| Chromosome: | chromosome 14 |
| Location: | 3645120 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g631350 | VSP7 | (1 of 8) PTHR11339:SF290 - PROTEIN T26A8.1; Hydroxyproline-rich glycoprotein, presumed cell wall component | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTGGTTGGGTGGGTGGATATGTGGGTGG |
| Internal bar code: | GGTGGCGCTCGGTTCCGAGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 196 |
| LEAP-Seq percent confirming: | 89.4984 |
| LEAP-Seq n confirming: | 1142 |
| LEAP-Seq n nonconfirming: | 134 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGCGTGCTGCTCCAATACTT |
| Suggested primer 2: | AACCTCACTGCCAAACTGCT |