| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.175535 |
| Chromosome: | chromosome 1 |
| Location: | 2768970 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g016450 | (1 of 1) IPR000104//IPR001214//IPR002893 - Antifreeze protein, type I // SET domain // Zinc finger, MYND-type; SET domain protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCTTTTGCGCTGGGCTGGGCGAGCTTC |
| Internal bar code: | CGGACGGCTAGATTCCTGACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 774 |
| LEAP-Seq percent confirming: | 95.818 |
| LEAP-Seq n confirming: | 779 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCTCCTGTCCTCTGTGGCT |
| Suggested primer 2: | GTCGAAGCAGTAGCTGTCCC |