Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.175548 |
Chromosome: | chromosome 17 |
Location: | 3787595 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g727700 | HEL65 | (1 of 2) K16911 - ATP-dependent RNA helicase DDX21 [EC:3.6.4.13] (DDX21); DEAD box ATP-dependent RNA helicase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCTACCTGCGCCTGGACGGGGAAGAGGC |
Internal bar code: | AAACGGTTTGGCTAGGCAAAGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 766 |
LEAP-Seq percent confirming: | 99.9257 |
LEAP-Seq n confirming: | 2689 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTCCTCCTGCGTACGAACAT |
Suggested primer 2: | GCTTCTGACAAAGTTTCGCC |