| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.175602 |
| Chromosome: | chromosome 13 |
| Location: | 2879137 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g583450 | EZY17 | Early zygote expressed protein; (1 of 6) PTHR15907:SF21 - DUF614 FAMILY PROTEIN | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCATCCAGGCAAGATAGAAGAAGATATGGG |
| Internal bar code: | TACTCTGGATCGCCGAAATCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 652 |
| LEAP-Seq percent confirming: | 77.3654 |
| LEAP-Seq n confirming: | 1063 |
| LEAP-Seq n nonconfirming: | 311 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCCGAAATAGCCGTAATC |
| Suggested primer 2: | TGTGTTACAAACGAAGGGCA |