| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.175804 |
| Chromosome: | chromosome 16 |
| Location: | 4417793 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g671150 | (1 of 1) PTHR12770//PTHR12770:SF22 - FAMILY NOT NAMED // UPF0420 PROTEIN C16ORF58 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGACCCCCGTTCCCCTGCCCCTGCCGCT |
| Internal bar code: | ACGTTTACGAATTAGCGTCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 696 |
| LEAP-Seq percent confirming: | 92.9742 |
| LEAP-Seq n confirming: | 5902 |
| LEAP-Seq n nonconfirming: | 446 |
| LEAP-Seq n unique pos: | 36 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACACGACACGCCACTACAC |
| Suggested primer 2: | CTGCAATAAACACGCACACC |