Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.175872 |
Chromosome: | chromosome 13 |
Location: | 5056855 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g607050 | TST,THT1,TSU1,TST1 | Thiosulfate sulfurtransferase; (1 of 1) K01011 - thiosulfate/3-mercaptopyruvate sulfurtransferase (TST, MPST, sseA) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAACCAAGGCCCAGAAGCAGCCCACAGGA |
Internal bar code: | GGGGGCGCTGTGTTCCAACATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 160 |
LEAP-Seq percent confirming: | 99.3333 |
LEAP-Seq n confirming: | 447 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGTCCATGGAAGACAGAGT |
Suggested primer 2: | GCTTCTTCGACATAGACGGC |