Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.175876 |
Chromosome: | chromosome 13 |
Location: | 1535034 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre13.g572850 | FBB17 | (1 of 6) PF00246 - Zinc carboxypeptidase (Peptidase_M14); Flagellar/basal body protein 17 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATTGCACACATGCCATCACCACAGCACA |
Internal bar code: | GGGAGATGCGCGGCTTAAATCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 644 |
LEAP-Seq percent confirming: | 74.8325 |
LEAP-Seq n confirming: | 4692 |
LEAP-Seq n nonconfirming: | 1578 |
LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGTGCCAATGTCTGAACG |
Suggested primer 2: | GCCTCTACAAACGCCTTCAC |