Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.175892 |
Chromosome: | chromosome 7 |
Location: | 2659205 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g330700 | FAP91,Cam-IP2 | Flagellar Associated Protein 91; (1 of 1) PF14738 - Solute carrier (proton/amino acid symporter), TRAMD3 or PAT1 (PaaSYMP) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTCGGCTCCGCAGGGGCGTCCATACAAT |
Internal bar code: | GACGATGGAGGGGGCTATAATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 718 |
LEAP-Seq percent confirming: | 94.9751 |
LEAP-Seq n confirming: | 2098 |
LEAP-Seq n nonconfirming: | 111 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTTATTGTTTGCGCATGGT |
Suggested primer 2: | GAGTTCAGTCTGGCAGGTGG |