| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.175922 |
| Chromosome: | chromosome 7 |
| Location: | 1082857 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g319800 | (1 of 1) IPR000104//IPR009148 - Antifreeze protein, type I // Streptococcal non-M secreted SibA | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTATTCTTGTGTTCTCGCTGGATGAAGG |
| Internal bar code: | ATCATTTTGGTGTGTCCCGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 443 |
| LEAP-Seq percent confirming: | 95.1009 |
| LEAP-Seq n confirming: | 1980 |
| LEAP-Seq n nonconfirming: | 102 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCGACATCCGACTAGAGTG |
| Suggested primer 2: | TGGCTCATTACTTTACGCCC |