| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.176020 |
| Chromosome: | chromosome 7 |
| Location: | 5138990 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g348040 | (1 of 4) PTHR11785//PTHR11785:SF367 - AMINO ACID TRANSPORTER // AMINO-ACID PERMEASE BAT1; Probable amino acid/metabolite permease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCCCCATGGCAGGTCCCACGGGCGGCAG |
| Internal bar code: | GGGACCGTAGCAGAAACAGTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 914 |
| LEAP-Seq percent confirming: | 99.707 |
| LEAP-Seq n confirming: | 1021 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGTGTGTGTGTGTGTGTGT |
| Suggested primer 2: | CCTCTCTCCCTGCAATTCTG |