Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.176232 |
Chromosome: | chromosome 15 |
Location: | 195099 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g635200 | BGY1 | BIGYIN-related tetratricopeptide protein; (1 of 1) PTHR13247:SF0 - MITOCHONDRIAL FISSION 1 PROTEIN | 5'UTR_intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCGAGAGGGCTCACGCGAGCTGTAGAGTC |
Internal bar code: | TCGGCATGCGACTGGCGCCTAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 821 |
LEAP-Seq percent confirming: | 97.4427 |
LEAP-Seq n confirming: | 97090 |
LEAP-Seq n nonconfirming: | 2548 |
LEAP-Seq n unique pos: | 224 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTTCTGGAGCACATGCTGAC |
Suggested primer 2: | ACACACACACACACACCACG |