| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.176330 |
| Chromosome: | chromosome 13 |
| Location: | 1983999 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g576600 | Conserved Protein with Similarity to Catalytic domain of Protein Tyrosine Kinases; (1 of 1) PTHR23257//PTHR23257:SF405 - SERINE-THREONINE PROTEIN KINASE // MITOGEN-ACTIVATED PROTEIN KINASE KINASE KINASE 7-LIKE-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTAAAACGCATTCCGCCGTAATGTGGACT |
| Internal bar code: | ATCTTGTCCGAATCTACAAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 278 |
| LEAP-Seq percent confirming: | 99.7382 |
| LEAP-Seq n confirming: | 762 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAACTGACAACTGCAGCCCT |
| Suggested primer 2: | TGTTGCACAGTTTCAGGCTC |