| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.176369 |
| Chromosome: | chromosome 7 |
| Location: | 1116075 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g320150 | ERJ1 | DnaJ-like protein, ER-targeted; (1 of 1) K09517 - DnaJ homolog subfamily B member 11 (DNAJB11) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTTGCAGAGCCACGTGGGTTTGCGGTCC |
| Internal bar code: | GTGCGATGCATAGTGGCACACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1095 |
| LEAP-Seq percent confirming: | 99.8527 |
| LEAP-Seq n confirming: | 3389 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGCTTCGATCAACATGAA |
| Suggested primer 2: | GGACCATTGTAGGTCATCCG |