Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.176374 |
Chromosome: | chromosome 3 |
Location: | 2388280 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g158850 | (1 of 1) PTHR24413:SF79 - BTB/POZ DOMAIN-CONTAINING PROTEIN 9 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTCAACCATGGGGTGCTCACTGTTGGGCA |
Internal bar code: | CAGGACGGAAGCGACATTTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 565 |
LEAP-Seq percent confirming: | 98.8976 |
LEAP-Seq n confirming: | 1256 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCTGAGAGTCAACAATGGC |
Suggested primer 2: | GATGAAGTCCAGGCAGAAGC |