Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.176381 |
Chromosome: | chromosome 6 |
Location: | 382316 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g251800 | RFC4 | (1 of 1) PTHR11669//PTHR11669:SF17 - REPLICATION FACTOR C / DNA POLYMERASE III GAMMA-TAU SUBUNIT // REPLICATION FACTOR C SUBUNIT 4; DNA replication factor C complex subunit 4 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGACGGGGGCCTTGCCTACGCCTGGTAGGG |
Internal bar code: | GAGATCGAAAGAATGTGCGTGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 113 |
LEAP-Seq percent confirming: | 90.6433 |
LEAP-Seq n confirming: | 155 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATTTTGAGCCCTTGTTGGT |
Suggested primer 2: | GATAAGCAGCTTGTAGGGCG |