| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.176472 |
| Chromosome: | chromosome 15 |
| Location: | 919337 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre15.g639350 | (1 of 5) IPR001005//IPR009057//IPR017877 - SANT/Myb domain // Homeodomain-like // Myb-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGAGGAAGAAGAGCTCTCGCACCACAGGCC |
| Internal bar code: | CACAGACGCACCATCGGTTTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 254 |
| LEAP-Seq percent confirming: | 48.9354 |
| LEAP-Seq n confirming: | 1333 |
| LEAP-Seq n nonconfirming: | 1391 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTGATCATCAAGAGGCGCT |
| Suggested primer 2: | ACAGGATGCATGCACTGAAG |