| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.176501 |
| Chromosome: | chromosome 9 |
| Location: | 2110500 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g393700 | MMP3 | Matrix metalloproteinase; (1 of 2) IPR016517 - Peptidase M11, autolysin | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGGCACTGACCTGGGGCCTGGCACGGGGAC |
| Internal bar code: | ACGCTGCGGGGGGCATGGAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 578 |
| LEAP-Seq percent confirming: | 99.7289 |
| LEAP-Seq n confirming: | 19129 |
| LEAP-Seq n nonconfirming: | 52 |
| LEAP-Seq n unique pos: | 199 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTTTGTTGAGGGTGTGCTT |
| Suggested primer 2: | GCTGACTCGCTCACTCACTG |