| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.176594 |
| Chromosome: | chromosome 13 |
| Location: | 4358068 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g602800 | (1 of 41) IPR000719//IPR011009 - Protein kinase domain // Protein kinase-like domain | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGGGATGGCCTTGCGGACGTAGCCTGGGC |
| Internal bar code: | TGGGGCCGTTCCATTCGACAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 841 |
| LEAP-Seq percent confirming: | 71.9813 |
| LEAP-Seq n confirming: | 4763 |
| LEAP-Seq n nonconfirming: | 1854 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCAGTTTGTCCCGCAAGTC |
| Suggested primer 2: | ATAACACTGGTGGCAAAGGC |