| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.176689 |
| Chromosome: | chromosome 16 |
| Location: | 5343321 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g681850 | (1 of 2) 2.4.2.9//2.7.1.48 - Uracil phosphoribosyltransferase / UMP pyrophosphorylase // Uridine kinase / Uridine monophosphokinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACCCCTTGACCTGCATTGGCACGGCAGC |
| Internal bar code: | TAGCGTGGTGTTTTAATCTCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1030 |
| LEAP-Seq percent confirming: | 99.467 |
| LEAP-Seq n confirming: | 1493 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGCATCAAGATTGGAAAGA |
| Suggested primer 2: | AGCAAAGTTGGTATCACCCG |