| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.176756 |
| Chromosome: | chromosome 6 |
| Location: | 5519021 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g284900 | CYN6,CYN20A,ROC7,CYN20-1 | Cyclophilin 20-1; (1 of 4) K01802 - peptidylprolyl isomerase (E5.2.1.8) | 5'UTR_intron|intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGAGAAAGGGGAGGCGTGCCGTGCCTGCAT |
| Internal bar code: | TTTAATCTACACTGTCCGCGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 684 |
| LEAP-Seq percent confirming: | 99.7438 |
| LEAP-Seq n confirming: | 1168 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCAAGCCCAGATCAACAT |
| Suggested primer 2: | ACCGCAGGAAGGTTAGGTTT |