| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.176799 |
| Chromosome: | chromosome 14 |
| Location: | 1282534 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g616600 | FZL,FZL1 | Plastid-localized; (1 of 1) PTHR11649//PTHR11649:SF36 - MSS1/TRME-RELATED GTP-BINDING PROTEIN // FZL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAGACCACAGTCAGATCTCTCGCGTCCC |
| Internal bar code: | TCATTTCCATTTACCAACTTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1060 |
| LEAP-Seq percent confirming: | 99.5423 |
| LEAP-Seq n confirming: | 1740 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTGAGCCTTACACCAGCC |
| Suggested primer 2: | AGGGAGAGGGGTCAATGTCT |