Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.176835 |
Chromosome: | chromosome 3 |
Location: | 4123223 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g173300 | (1 of 6) IPR007577//IPR029044 - Glycosyltransferase, DXD sugar-binding motif // Nucleotide-diphospho-sugar transferases | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTATTTCAACCATTGTTTAAGGCGAAGTTT |
Internal bar code: | AGGAACGCGGGTTGCATGGTCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 997 |
LEAP-Seq percent confirming: | 97.8134 |
LEAP-Seq n confirming: | 2505 |
LEAP-Seq n nonconfirming: | 56 |
LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGATCCAAAACAACGGCT |
Suggested primer 2: | TGATTGAGAAGCATGGCAAG |