| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.176865 |
| Chromosome: | chromosome 14 |
| Location: | 2599898 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g625850 | MMP32 | Matrix metalloproteinase; (1 of 1) IPR003980//IPR008752 - Histamine H3 receptor // Peptidase M11, gametolysin | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCACACAAAACACGCACACACTCAGCTC |
| Internal bar code: | GTACTGAAAATATATCTAGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 655 |
| LEAP-Seq percent confirming: | 93.8813 |
| LEAP-Seq n confirming: | 1519 |
| LEAP-Seq n nonconfirming: | 99 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCACACACACACACACACG |
| Suggested primer 2: | TAAACGCATTCTTCTGCACG |