| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.176884 |
| Chromosome: | chromosome 8 |
| Location: | 4949774 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g385500 | AMYA1,AMA1 | Alpha-amylase 1; (1 of 3) K01176 - alpha-amylase (E3.2.1.1, amyA, malS) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCATTGTCCCTGTGTCGTTAAGCCACAC |
| Internal bar code: | AGCTGTGATTGCTCGTGCGCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 824 |
| LEAP-Seq percent confirming: | 98.0523 |
| LEAP-Seq n confirming: | 3826 |
| LEAP-Seq n nonconfirming: | 76 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGAATGAGAGGAGCAGGG |
| Suggested primer 2: | GGTCAGTTGGTCTTCTCCCA |