| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.176914 |
| Chromosome: | chromosome 10 |
| Location: | 805305 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g423300 | (1 of 1) 3.4.22.40 - Bleomycin hydrolase / Aminopeptidase C (Lactococcus lactis) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACGAGGGGAAGCCAAACTCCGCAGCCGC |
| Internal bar code: | GGGGCAGCATCGGCTCACCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 628 |
| LEAP-Seq percent confirming: | 55.814 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTACCCAGCACGCCTAATTC |
| Suggested primer 2: | TACTTTGTGGATGACGCAGC |