Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.176936 |
Chromosome: | chromosome 9 |
Location: | 1212348 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g399914 | SSA8 | cilia-sensing, structure and/or assembly; (1 of 1) K10766 - alkylated DNA repair protein alkB homolog 4 (ALKBH4) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGACTGAGTCCTATGTCGGACGTGTCGGA |
Internal bar code: | CACCGATTTCGTCGACTGCCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 800 |
LEAP-Seq percent confirming: | 98.3471 |
LEAP-Seq n confirming: | 476 |
LEAP-Seq n nonconfirming: | 8 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCGGTAGAGAAGGCATGAA |
Suggested primer 2: | ATAAAGGTGAAGAGCGCGAA |