Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.177092 |
Chromosome: | chromosome 9 |
Location: | 5959476 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g402812 | (1 of 6) PF02656 - Domain of unknown function (DUF202) (DUF202) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCATGGCTTCCCCAAAGCATTTGCAATG |
Internal bar code: | TACGACAACGGGCGAAGTCTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 290 |
LEAP-Seq percent confirming: | 99.8001 |
LEAP-Seq n confirming: | 1498 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TAACCCCTGTCGTAACTGCC |
Suggested primer 2: | TACTTTCAACCCGGTCTTGC |