Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.177233 |
Chromosome: | chromosome 11 |
Location: | 375328 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467576 | (1 of 1) PTHR33403//PTHR33403:SF5 - FAMILY NOT NAMED // PROTEIN SPIRAL1-LIKE 2-RELATED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATAGCCGGCAGGCAGCCGTGCTGATACAAG |
Internal bar code: | GTTATGTCGGCCGAGAGGGAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 471 |
LEAP-Seq percent confirming: | 99.4152 |
LEAP-Seq n confirming: | 170 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCCAATTGTAACTGCCGAGT |
Suggested primer 2: | CTGTGCCTGTATGCACTGCT |