| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.177306 |
| Chromosome: | chromosome 17 |
| Location: | 1318383 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g705850 | GGK2,PROB2 | Glutamate 5-kinase; (1 of 3) 2.7.2.11 - Glutamate 5-kinase / Gamma-glutamyl kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGGCCGCCCAGTCTGGGCCACGGTCTGA |
| Internal bar code: | GGCCCACACGTGGCAAAGGAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1060 |
| LEAP-Seq percent confirming: | 99.4307 |
| LEAP-Seq n confirming: | 1048 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTCTGATGCTGAATGAGG |
| Suggested primer 2: | TCCGTGTTCGGCTTTTAATC |