| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.177345 |
| Chromosome: | chromosome 17 |
| Location: | 5456733 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g737100 | FAP127 | (1 of 1) PTHR19265:SF0 - MEIOSIS-SPECIFIC NUCLEAR STRUCTURAL PROTEIN 1; Flagellar Associated Protein 127 | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGCCAAGATGTCGGCCTGTGACTGCACA |
| Internal bar code: | CGTAGGGGGCCGACGTTGGCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 533 |
| LEAP-Seq percent confirming: | 99.5192 |
| LEAP-Seq n confirming: | 1449 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCAGGAGCTTCGTGACCTT |
| Suggested primer 2: | CCTGGTACAAGCTCTCCAGC |