| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.177355 |
| Chromosome: | chromosome 1 |
| Location: | 4130784 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g027200 | UBC12 | E2 Ubiquitin conjugating enzyme; (1 of 1) K10576 - ubiquitin-conjugating enzyme E2 H (UBE2H, UBC8) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAACACGCCGGCTTCCTCATGAGTGAGAA |
| Internal bar code: | TTTTGACCTTGAGCGAGGCCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 483 |
| LEAP-Seq percent confirming: | 99.6482 |
| LEAP-Seq n confirming: | 1133 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCGTCAACAACAAGAGCAG |
| Suggested primer 2: | AGCCTCCTGCTCATGTCCTA |