| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.177357 |
| Chromosome: | chromosome 2 |
| Location: | 6201698 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g113850 | PBGD2,HMBS,HEM3 | (1 of 1) PTHR11557//PTHR11557:SF0 - PORPHOBILINOGEN DEAMINASE // PORPHOBILINOGEN DEAMINASE; Porphobilinogen deaminase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACTTGTTAGGAGCGGCGCCAGGAACACA |
| Internal bar code: | CCATCTCTCGCCTGTCTGACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 99.7738 |
| LEAP-Seq n confirming: | 1764 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACAGTCGTGTTTAGGGGCAC |
| Suggested primer 2: | GCACACACACACACCCCTAC |