| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.177372 |
| Chromosome: | chromosome 13 |
| Location: | 2458642 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g579901 | DEG6 | (1 of 2) PTHR22939:SF67 - PROTEASE DO-LIKE 9; Deg protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGTGAACGGAGCGGGTGACGCTGCGTTG |
| Internal bar code: | GGGGACGTTGGATCTAAATAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 182 |
| LEAP-Seq percent confirming: | 99.65 |
| LEAP-Seq n confirming: | 3132 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAGGAAGACCATTAGCAA |
| Suggested primer 2: | ATGTGCCTGGATCTGGTCTC |