| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.177389 |
| Chromosome: | chromosome 16 |
| Location: | 3220793 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g666550 | SOUL3 | SOUL heme-binding protein; (1 of 2) PTHR11220:SF35 - SOUL HEME-BINDING PROTEIN | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGTAGCTTGGTGCTGTTGCGGCTTTCTGT |
| Internal bar code: | CATAGGCGGCAGCATGGGGACC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 934 |
| LEAP-Seq percent confirming: | 97.1163 |
| LEAP-Seq n confirming: | 1987 |
| LEAP-Seq n nonconfirming: | 59 |
| LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCGACGTGCTGAGGTATG |
| Suggested primer 2: | ACCATCCTTAAGGGACCCAC |