| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.177425 |
| Chromosome: | chromosome 3 |
| Location: | 7551807 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g205050 | CGLD24,DOT1,DGTT4 | Diacylglycerol acyltransferase, DGAT Type 2; (1 of 4) K14457 - 2-acylglycerol O-acyltransferase 2 (MOGAT2, MGAT2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTTGCGCACCCCCTCCCCCGCCCAAGCTC |
| Internal bar code: | GAGCTGATTCGTCCGATAGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 269 |
| LEAP-Seq percent confirming: | 96.1538 |
| LEAP-Seq n confirming: | 725 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTCTGAATGCGTTGACGAAG |
| Suggested primer 2: | CGATGCCACTACGATACCCT |