Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.177451 |
Chromosome: | chromosome 4 |
Location: | 3372220 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g227500 | SRR18 | Scavenger receptor cysteine rich (SRCR) protein; (1 of 2) IPR001190//IPR006626//IPR011050//IPR017448 - SRCR domain // Parallel beta-helix repeat // Pectin lyase fold/virulence factor // SRCR-like domain | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCGTTCTGTCACATGCGTGATTGAATGC |
Internal bar code: | TTGCAGCCTAAGGACGATGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 527 |
LEAP-Seq percent confirming: | 94.2387 |
LEAP-Seq n confirming: | 229 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACCCTGAGTTCTTCTCCCC |
Suggested primer 2: | CAGCGGTGAATTAGCAGTGA |