Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.177477 |
Chromosome: | chromosome 17 |
Location: | 6089924 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g741350 | KIN7-4,KIN7D | Kinesin motor protein; (1 of 4) K11498 - centromeric protein E (CENPE) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGAAGAGGAGCTGGCGGCGGCGGCGGC |
Internal bar code: | ACACTCCTCCTGTAACCGCGAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 106 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 8 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAAGATTTCCAACTCCGCTG |
Suggested primer 2: | GAAGGCAGCAGCGTCAGT |