| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.177519 |
| Chromosome: | chromosome 16 |
| Location: | 2896609 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g663750 | (1 of 10) PF13519 - von Willebrand factor type A domain (VWA_2) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGGTCATTCCCCGCATACACATTACACA |
| Internal bar code: | GATGCAGGAGTGGAAGCGCGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 627 |
| LEAP-Seq percent confirming: | 98.3578 |
| LEAP-Seq n confirming: | 105471 |
| LEAP-Seq n nonconfirming: | 1761 |
| LEAP-Seq n unique pos: | 189 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATGATAGGGTCGTGTGTG |
| Suggested primer 2: | GCGCATTTCGTTTCCTTAAA |