| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.177625 |
| Chromosome: | chromosome 8 |
| Location: | 1423135 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g364300 | FAP29 | (1 of 3) PTHR10338//PTHR10338:SF110 - VON WILLEBRAND FACTOR, TYPE A DOMAIN CONTAINING // VON WILLEBRAND FACTOR A DOMAIN-CONTAINING PROTEIN 5A; von Willebrand Factor Type A Domain Flagellar Associated Protein 29 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCCAAGTCCACAGGCCGCCCCACCCCGC |
| Internal bar code: | GAAACACTCGGAAATGGCCCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 481 |
| LEAP-Seq percent confirming: | 22.0353 |
| LEAP-Seq n confirming: | 262 |
| LEAP-Seq n nonconfirming: | 927 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGCAGTAACCAATCCCCA |
| Suggested primer 2: | TTACAAGGTACTGGCGGGAC |