Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.177698 |
Chromosome: | chromosome 6 |
Location: | 6245181 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g290900 | (1 of 1) PF06294//PF11971 - CH-like domain in sperm protein (CH_2) // CAMSAP CH domain (CAMSAP_CH) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCTGGCCCCCAAACGTGCAGCACGTCTG |
Internal bar code: | CGGAAAGGCGGTGCTCGGGGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 932 |
LEAP-Seq percent confirming: | 99.5609 |
LEAP-Seq n confirming: | 907 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CATCTGCTGCTGGTAGGTGA |
Suggested primer 2: | GACCCACAAACAACTGGCTT |