| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.177713 |
| Chromosome: | chromosome 11 |
| Location: | 1781065 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467350 | ACO2 | Acyl-CoA oxidase/dehydrogenase; (1 of 1) PF01756//PF02770 - Acyl-CoA oxidase (ACOX) // Acyl-CoA dehydrogenase, middle domain (Acyl-CoA_dh_M) | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTTACAACGTTTCGGTGAAATTCTTCTT |
| Internal bar code: | GGACAAACTTTGGAACTAACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 46.6981 |
| LEAP-Seq n confirming: | 99 |
| LEAP-Seq n nonconfirming: | 113 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTCTTGGAGCAAGAGGCAC |
| Suggested primer 2: | GGGTTGTCAATGCTGTGATG |