| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.177739 |
| Chromosome: | chromosome 1 |
| Location: | 5165554 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g035950 | (1 of 1) K03321 - sulfate permease, SulP family (TC.SULP) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAATCATGAATGTAACCCCCCCTGCAGGAA |
| Internal bar code: | AAGATAGGGATGCAAGGATATT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 374 |
| LEAP-Seq percent confirming: | 88.4615 |
| LEAP-Seq n confirming: | 23 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCACGAACACACACACACAC |
| Suggested primer 2: | GGATTTGTCCTTCCCCATTT |