| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.177932 |
| Chromosome: | chromosome 3 |
| Location: | 2789082 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g162100 | PIMT2 | Protein-L-isoaspartate O-methyltransferase; (1 of 3) K00573 - protein-L-isoaspartate(D-aspartate) O-methyltransferase (E2.1.1.77, pcm) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCGCTGCCCAGGCCATCAACTACGCCAA |
| Internal bar code: | GTCCGCGTGCTCCCAGGCCTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 686 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 358 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTGTTTTGGACTGTGCGA |
| Suggested primer 2: | ACACGACAGTGCGTTTGTTC |